SIRT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10830-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SIRT2 Reagents

CRO Services

Product recommended


All SIRT2 Reagents

SIRT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1059 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae), transcript variant 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI (6kb + 1.1kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SIRT2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human SIRT2 Gene Expression validated Image 1636
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619

SIRT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

SIR2 cDNA ORF Clone, Human;SIR2L cDNA ORF Clone, Human;SIR2L2 cDNA ORF Clone, Human

SIRT2 Background Information

Full Name
sirtuin 2

SIRT2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90540-G
SIRT2 cDNA ORF Clone, Cynomolgus, untagged CG90540-UT
SIRT2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90540-ACG
SIRT2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90540-ACGLN
SIRT2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90540-ANG
SIRT2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90540-ACR
SIRT2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90540-ANR
SIRT2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90540-CF
SIRT2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90540-NF
SIRT2 cDNA ORF Clone, Cynomolgus, C-His tag CG90540-CH
SIRT2 cDNA ORF Clone, Cynomolgus, N-His tag CG90540-NH
SIRT2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90540-CY
SIRT2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90540-NY
SIRT2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90540-CM
SIRT2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90540-NM

SIRT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Rat RG80973-U
SIRT2 cDNA ORF Clone, Rat, untagged RG80973-UT
SIRT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80973-ACGLN
SIRT2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80973-ACG
SIRT2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80973-ANG
SIRT2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80973-ACR
SIRT2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80973-ANR
SIRT2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80973-CF
SIRT2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80973-NF
SIRT2 cDNA ORF Clone, Rat, C-His tag RG80973-CH
SIRT2 cDNA ORF Clone, Rat, N-His tag RG80973-NH
SIRT2 cDNA ORF Clone, Rat, C-HA tag RG80973-CY
SIRT2 cDNA ORF Clone, Rat, N-HA tag RG80973-NY
SIRT2 cDNA ORF Clone, Rat, C-Myc tag RG80973-CM
SIRT2 cDNA ORF Clone, Rat, N-Myc tag RG80973-NM
SIRT2 qPCR Primer Pairs, Rat RP300937

SIRT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Mouse MG50566-G
SIRT2 cDNA ORF Clone, Mouse, untagged MG50566-UT
SIRT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50566-ACGLN
SIRT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50566-ACG
SIRT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50566-ANG
SIRT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50566-ACR
SIRT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50566-ANR
SIRT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50566-CF
SIRT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50566-NF
SIRT2 cDNA ORF Clone, Mouse, C-His tag MG50566-CH
SIRT2 cDNA ORF Clone, Mouse, N-His tag MG50566-NH
SIRT2 cDNA ORF Clone, Mouse, C-HA tag MG50566-CY
SIRT2 cDNA ORF Clone, Mouse, N-HA tag MG50566-NY
SIRT2 cDNA ORF Clone, Mouse, C-Myc tag MG50566-CM
SIRT2 cDNA ORF Clone, Mouse, N-Myc tag MG50566-NM
SIRT2 qPCR Primer Pairs, Mouse MP200558

SIRT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SIRT2 cDNA ORF Clone in Cloning Vector, Human HG10830-M
SIRT2 cDNA ORF Clone, Human, untagged HG10830-UT
SIRT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10830-ACG
SIRT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10830-ACGLN
SIRT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10830-ANG
SIRT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10830-ACR
SIRT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10830-ANR
SIRT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10830-NF
SIRT2 cDNA ORF Clone, Human, C-His tag HG10830-CH
SIRT2 cDNA ORF Clone, Human, N-His tag HG10830-NH
SIRT2 cDNA ORF Clone, Human, C-HA tag HG10830-CY
SIRT2 cDNA ORF Clone, Human, N-HA tag HG10830-NY
SIRT2 cDNA ORF Clone, Human, C-Myc tag HG10830-CM
SIRT2 cDNA ORF Clone, Human, N-Myc tag HG10830-NM
SIRT2 qPCR Primer Pairs, Human HP100730
info info
添加购物车成功! 添加购物车失败!