After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SIM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC110444
Размер кДНК:1713bp
Описание кДНК:Full length Clone DNA of Homo sapiens single-minded homolog 2 (Drosophila) with C terminal His tag.
Синоним гена:SIM, bHLHe15, HMC13F06, HMC29C01
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15741-ACGRBS16764
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15741-ACRRBS16760
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15741-ANGRBS16764
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15741-ANRRBS16760
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15741-CFRBS14711
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15741-CHRBS14711
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15741-CMRBS14711
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15741-CYRBS14711
Человек SIM2 Джин клон кДНК в вектор клонированияHG15741-GRBS5132
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15741-NFRBS14711
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15741-NHRBS14711
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15741-NMRBS14711
Человек SIM2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15741-NYRBS14711
Человек SIM2 Джин ORF экспрессии кДНК клона плазмидыHG15741-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15741-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».