After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SIGIRR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC003591
Размер кДНК:1233bp
Описание кДНК:Full length Clone DNA of Homo sapiens single immunoglobulin and toll-interleukin 1 recep with C terminal Myc tag.
Синоним гена:TIR8, MGC110992, SIGIRR
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12165-ACGRBS15400
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12165-ACRRBS15400
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12165-CFRBS13340
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12165-CHRBS13340
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12165-CMRBS13340
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12165-CYRBS13340
Человек SIGIRR/TIR8 Джин клон кДНК в вектор клонированияHG12165-GRBS5130
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12165-NFRBS13340
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12165-NHRBS13340
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12165-NMRBS13340
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12165-NYRBS13340
Человек SIGIRR/TIR8 Джин ORF экспрессии кДНК клона плазмидыHG12165-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Single Ig IL-1-related receptor (SIGIRR) or TIR8 is a member of Toll-like receptor-interleukin 1 receptor signaling (TLR-IL-1R) receptor superfamily. Although SIGIRR/TIR8 shows the typical conserved motifs that characterize the IL-1R and Toll superfamily, it is structurally and functionally distinct from both. SIGIRR/TIR8 has only one Ig domain in its extracellular portion whereas the IL-1R family contains three Ig folds. An unusually long cytoplasmic domain is reminiscent of the structure of drosophila Toll, yet the SIGIRR peptide sequence is more closely related to IL-1RI. SIGIRR/TIR8 was mainly expressed in mouse and human epithelial tissues such as kidney, lung and gut. Resting and activated T and B lymphocytes and monocytes-macrophages expressed little or no SIGIRR/TIR8, with the exception of the mouse GG2EE macrophage line. Inflammation is enhanced in SIGIRR-deficient mice. SIGIRR negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge.

Ссылки
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Polentarutti N, et al. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR. Eur Cytokine Netw. 14(4): 211-8.
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Size / Price
    Каталог: HG12165-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».