Быстрый заказ

Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SIAE Информация о продукте «Клон cDNA»
Размер кДНК:1572bp
Описание кДНК:Full length Clone DNA of Homo sapiens sialic acid acetylesterase with C terminal Flag tag.
Синоним гена:LSE, AIS6, CSEC, YSG2, CSE-C, MGC87009, SIAE
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13310-ACGRBS16760
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13310-ACRRBS16760
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13310-CFRBS14710
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13310-CHRBS14710
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13310-CMRBS14710
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13310-CYRBS14710
Человек sialate O-acetylesterase Джин клон кДНК в вектор клонированияHG13310-GRBS5130
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13310-NFRBS14710
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13310-NHRBS14710
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13310-NMRBS14710
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13310-NYRBS14710
Человек sialate O-acetylesterase Джин ORF экспрессии кДНК клона плазмидыHG13310-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Sialate O-acetylesterase belongs to the family of hydrolases, specifically those acting on carboxylic ester bonds. It is widely expressed with high expression in the testis, prostate, and colon. The systematic name of this enzyme class is N-acyl-O-acetylneuraminate O-acetylhydrolase. Other names in common use include N-acetylneuraminate acetyltransferase, sialate 9(4)-O-acetylesterase, and sialidase. Sialate O-acetylesterase catalyzes the removal of O-acetyl ester groups from position 9 of the parent sialic acid, N-acetylneuraminic acid. Defects in Sialate O-acetylesterase are a cause of autoimmune disease type 6 (AIS6). Individuals manifesting susceptibility to autoimmune disease type 6 can suffer from juvenile idiopathic arthritis, rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, systemic lupus erythematosus, type 1 diabetes, ulcerative colitis, and Crohn disease.

  • Mandal C, et al. (2012) Regulation of O-acetylation of sialic acids by sialate-O-acetyltransferase and sialate-O-acetylesterase activities in childhood acute lymphoblastic leukemia. Glycobiology. 22(1): 70-83.
  • Tsai S, et al. (2011) Transcriptional profiling of human placentas from pregnancies complicated by preeclampsia reveals disregulation of sialic acid acetylesterase and immune signalling pathways. Placenta. 32 (2): 175-82.
  • Surolia I, et al. (2010) Functionally defective germline variants of sialic acid acetylesterase in autoimmunity. Nature. 466 (7303): 243-7.
  • Size / Price
    Каталог: HG13310-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.