After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SH2D1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002351.3
Размер кДНК:387bp
Описание кДНК:Full length Clone DNA of Homo sapiens SH2 domain protein 1A with C terminal HA tag.
Синоним гена:LYP, SAP, XLP, DSHP, EBVS, IMD5, XLPD, MTCP1, FLJ18687, FLJ92177, SH2D1A
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11149-ACGRBS15400
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11149-ACRRBS15400
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11149-ANGRBS15400
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11149-ANRRBS15400
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11149-CFRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11149-CHRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11149-CMRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11149-CYRBS13340
Человек SH2D1A Джин клон кДНК в вектор клонированияHG11149-MRBS5130
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11149-M-FRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11149-NFRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11149-NHRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11149-NMRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11149-NYRBS13340
Человек SH2D1A Джин ORF экспрессии кДНК клона плазмидыHG11149-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SH2 domain-containing protein 1A (SH2D1A / SAP) is a 128 amino acid protein, containing a single Src homology 2 (SH2) domain, flanked by 5 amino acids at the N-terminus and 25 amino acids at the C-terminus. The absence of a catalytic domain and the presence of an SH2 domain suggest that SH2D1A regulates one or more signal transduction pathways. SH2D1A interacts with signaling lymphocytic activation molecule (SLAM), which is a transmembrane protein expressed on the surface of activated T and B cells. SH2D1A (SAP) interacts via its SH2 domain with a motif (TIYXXV) present in the cytoplasmic tail of the cell-surface receptors, including CD150 / SLAM, CD84, CD229 / Ly-9, and CD244 / 2B4. SH2D1A was expressed in EBV-carrying, tumor phenotype representative (type I), but not in EBV-carrying lymphoblastoid cell line (LCL)-like (type III) or EBV-negative Burkitt lymphoma (BL) lines. It has been supposed to be related to the X-linked lymphoproliferative disease which is also known as Duncan's disease or Purtilo syndrome. 

Ссылки
  • Morra M, et al. (2005) Defective B cell responses in the absence of SH2D1A. PNAS. 102 (13): 4819-23.
  • Morra M, et al. (2001) Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients. The Journal of Biological Chemistry. 276: 36809-16.
  • Hron JD, et al. (2004) SH2D1A Regulates T-dependent Humoral Autoimmunity. JEM. 200 (2): 261-6.
  • Size / Price
    Каталог: HG11149-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».