SEZ6L2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

SEZ6L2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2430 bp
Description
Full length Clone DNA of Human seizure related 6 homolog (mouse)-like 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SEZ6L2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

PSK-1 cDNA ORF Clone, Human

SEZ6L2 Background Information

SEZ6L2, also known as PSK-1, belongs to the SEZ6 family. It contains 3 CUB domains and 5 Sushi (CCP/SCR) domains. SEZ6L2 may contribute to specialized endoplasmic reticulum functions in neurons.SEZ6L2 presents on the surface of lung-cancer cells. SEZ6L2 should be a useful prognostic marker of lung cancers. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer.
Full Name
seizure related 6 homolog (mouse)-like 2
References
  • Bedoyan JK. et al., 2010, Am J Med Genet A. 152A (6): 1567-74.
  • Konyukh M. et al., 2011, PLoS One. 6 (3): e17289.
  • Wang J. et al., 2011, Mol Syst Biol. 7: 536.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait