Быстрый заказ

Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SEZ6 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_178860.4
    Размер кДНК:2985bp
    Описание кДНК:Full length Clone DNA of Homo sapiens seizure related 6 homolog (mouse) with C terminal HA tag.
    Синоним гена:SEZ6
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SEZ6 qPCR primers for gene expression analysis, HP102138 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13436-ACGRBS22240
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13436-ACRRBS22240
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13436-CFRBS20190
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13436-CHRBS20190
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13436-CMRBS20190
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13436-CYRBS20190
    Человек SEZ6 Джин клон кДНК в вектор клонированияHG13436-GRBS5130
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13436-NFRBS20190
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13436-NHRBS20190
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13436-NMRBS20190
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13436-NYRBS20190
    Человек SEZ6 Джин ORF экспрессии кДНК клона плазмидыHG13436-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13436-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».