Быстрый заказ

Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SETDB2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC047434
    Размер кДНК:2124bp
    Описание кДНК:Full length Clone DNA of Homo sapiens SET domain, bifurcated 2.
    Синоним гена:CLLD8, CLLL8, KMT1F, C13orf4
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SETDB2 qPCR primers for gene expression analysis, HP103827 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15201-ACGRBS16760
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15201-ACRRBS16760
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15201-ANGRBS16760
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15201-ANRRBS16760
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15201-CFRBS14710
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15201-CHRBS14710
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15201-CMRBS14710
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15201-CYRBS14710
    Человек SETDB2 Джин клон кДНК в вектор клонированияHG15201-GRBS5130
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15201-NFRBS14710
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15201-NHRBS14710
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15201-NMRBS14710
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15201-NYRBS14710
    Человек SETDB2 Джин ORF экспрессии кДНК клона плазмидыHG15201-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».