After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human SETDB2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC047434
Размер кДНК:2124bp
Описание кДНК:Full length Clone DNA of Homo sapiens SET domain, bifurcated 2.
Синоним гена:CLLD8, CLLL8, KMT1F, C13orf4
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15201-ACGRBS16760
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15201-ACRRBS16760
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15201-ANGRBS16760
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15201-ANRRBS16760
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15201-CFRBS14710
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15201-CHRBS14710
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15201-CMRBS14710
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15201-CYRBS14710
Человек SETDB2 Джин клон кДНК в вектор клонированияHG15201-GRBS5130
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15201-NFRBS14710
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15201-NHRBS14710
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15201-NMRBS14710
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15201-NYRBS14710
Человек SETDB2 Джин ORF экспрессии кДНК клона плазмидыHG15201-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15201-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».