Быстрый заказ

Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Человек SESTD1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC047578
Размер кДНК:2091bp
Описание кДНК:Full length Clone DNA of Homo sapiens SEC14 and spectrin domains 1.
Синоним гена:SOLO
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SESTD1 qPCR primers for gene expression analysis, HP103824 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15198-ACGRBS16760
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15198-ACRRBS16760
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15198-ANGRBS16760
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15198-ANRRBS16760
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15198-CFRBS14710
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15198-CHRBS14710
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15198-CMRBS14710
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15198-CYRBS14710
Человек SESTD1 Джин клон кДНК в вектор клонированияHG15198-GRBS5130
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15198-NFRBS14710
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15198-NHRBS14710
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15198-NMRBS14710
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15198-NYRBS14710
Человек SESTD1 Джин ORF экспрессии кДНК клона плазмидыHG15198-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15198-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».