After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SERPINI1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001122752.1
Размер кДНК:1233bp
Описание кДНК:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade I (neuroserpin), member 1 with C terminal His tag.
Синоним гена:PI12, neuroserpin, DKFZp781N13156
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11107-ACGRBS15400
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11107-ACRRBS15400
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11107-CFRBS13340
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11107-CHRBS13340
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11107-CMRBS13340
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11107-CYRBS13340
Человек Neuroserpin/SerpinI1 Джин клон кДНК в вектор клонированияHG11107-MRBS5130
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11107-NFRBS13340
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11107-NHRBS13340
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11107-NMRBS13340
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11107-NYRBS13340
Человек Neuroserpin/SerpinI1 Джин ORF экспрессии кДНК клона плазмидыHG11107-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Neuroserpin, also known as Protease inhibitor 12 and SERPINI1, is a secreted protein which belongs to the serpin family. Neuroserpin is a serine protease inhibitor that inhibits plasminogen activators and plasmin but not thrombin. Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. Neuroserpin is predominantly expressed in the brain, and is expressed in the late stages of neurogenesis during the process of synapse formation. Overexpression of neuroserpin in an anterior pituitary corticotroph cell line results in the extension of neurite-like processes, suggesting that neuroserpin may play a role in cell communication, cell adhesion, and/or cell migration. Neuroserpin may be involved in the formation or reorganization of synaptic connections, as well as synaptic plasticity in the adult nervous system. Neuroserpin may also protect neurons from cell damage by tissue-type plasminogen activator. Defects of neuroserpin are the cause of familial encephalopathy with neuroserpin inclusion bodies (FEN1B).

Ссылки
  • Schrimpf SP. et al., 1997, Genomics. 40 (1): 55-62.
  • Hill RM. et al., 2002, Ann N Y Acad Sci. 971: 406-15.
  • Yepes M. et al., 2004, Thromb. Haemost. 91 (3): 457-64.
  • Galliciotti G. et al., 2006, Front Biosci. 11: 33-45.
  • Size / Price
    Каталог: HG11107-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».