Быстрый заказ

Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SERPINF1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_002615.4
    Размер кДНК:1257bp
    Описание кДНК:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 with C terminal His tag.
    Синоним гена:PEDF, EPC-1, PIG35
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SerpinF1 qPCR primers for gene expression analysis, HP101019 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11104-ACGRBS15400
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11104-ACRRBS15400
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11104-CFRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11104-CHRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11104-CMRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11104-CYRBS13340
    Человек PEDF Джин клон кДНК в вектор клонированияHG11104-MRBS5130
    Человек PEDF Джин ORF экспрессии кДНК клона плазмидыHG11104-M-NRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11104-NFRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11104-NHRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11104-NMRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11104-NYRBS13340
    Человек PEDF Джин ORF экспрессии кДНК клона плазмидыHG11104-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

    Ссылки
  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.
  • Size / Price
    Каталог: HG11104-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».