After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SERPINF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002615.4
Размер кДНК:1257bp
Описание кДНК:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 with C terminal His tag.
Синоним гена:PEDF, EPC-1, PIG35
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11104-ACGRBS15400
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11104-ACRRBS15400
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11104-CFRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11104-CHRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11104-CMRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11104-CYRBS13340
Человек PEDF Джин клон кДНК в вектор клонированияHG11104-MRBS5130
Человек PEDF Джин ORF экспрессии кДНК клона плазмидыHG11104-M-NRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11104-NFRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11104-NHRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11104-NMRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11104-NYRBS13340
Человек PEDF Джин ORF экспрессии кДНК клона плазмидыHG11104-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Pigment epithelium-derived factor, also known as PEDF, Serpin F1, and SERPINF1, is a multiple functional protein which has both anti-angiogenic activity and neurotrophic activity at the same time. PEDF is a secreted glycoprotein that belongs to the noninhibitory serpin. It has an alpha/beta core serine-protease inhibitor domain, three major beta-sheets, and ten alpha-helices. PEDF does not inhibit either serine or cysteine proteinases. PEDF exerts diverse physiological activities including anti-angiogenesis, anti-vasopermeability, anti-tumor, and neurotrophic activities. PEDF acts via multiple high affinity ligands and cell receptors. It has been described as a natural angiogenesis inhibitor with neurotrophic and immune-modulation properties. PEDF induces macrophages apoptosis and necrosis through the activation of peroxisome proliferator-activated receptor-gamma by which PEDF could modulate inflammatory reactions in septic shock. It balances angiogenesis in the eye and blocks tumor progression.

Ссылки
  • Ren, JG. et al., 2005, Med Hypotheses. 64 (1): 74-8.
  • Filleur, S. et al., 2009. J Cell Biochem. 106 (5): 769-75.
  • Kawaguchi, T. et al., 2010, Curr Mol Med. 10 (3): 302-11.
  • Yamagishi, SI. et al., 2010, Curr Mol Med. 10 (3): 284-91.
  • Nakamura, T. et al., 2010, Curr Mol Med. 10 (3): 312-6.
  • Size / Price
    Каталог: HG11104-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».