SERPINB1 cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

SERPINB1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade B (ovalbumin), member 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SERPINB1 cDNA ORF Clone, Human, untagged: Alternative Names

EI cDNA ORF Clone, Human; ELANH2 cDNA ORF Clone, Human; HEL-S-27 cDNA ORF Clone, Human; HEL57 cDNA ORF Clone, Human; LEI cDNA ORF Clone, Human; M/NEI cDNA ORF Clone, Human; MNEI cDNA ORF Clone, Human; PI-2 cDNA ORF Clone, Human; PI2 cDNA ORF Clone, Human

SERPINB1 Background Information

SerpinB1 is an endogenous inhibitor of serine proteases recognized for its anti-inflammatory and host-protective properties. Serum SerpinB1 levels are elevated in patients with type 2 diabetes compared with that in healthy subjects and are negatively correlated with serum LDL-C. serpinB1 as an endogenous protein that can potentially be harnessed to enhance functional beta cell mass in patients with diabetes.
Full Name
serpin peptidase inhibitor, clade B (ovalbumin), member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait