Быстрый заказ

Text Size:AAA

Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SERPINA10 Информация о продукте «Клон cDNA»
Размер кДНК:1335bp
Описание кДНК:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 with C terminal Flag tag.
Синоним гена:PZI, ZPI
Участок рестрикции:HindIII + XbaI (6kb + 1.37kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SERPINA10 Gene Plasmid Map
Human SERPINA10 ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10992-ACGRBS15400
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10992-ACRRBS15400
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10992-CFRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10992-CHRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10992-CMRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10992-CYRBS13340
Человек SerpinA10 Джин клон кДНК в вектор клонированияHG10992-MRBS5130
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмидыHG10992-M-NRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10992-NFRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10992-NHRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10992-NMRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10992-NYRBS13340
Человек SerpinA10 Джин ORF экспрессии кДНК клона плазмидыHG10992-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Mouse protein Z-dependent protease inhibitor, also known as PZ-dependent protease inhibitor, SERPINA10 and ZPI, is a secreted protein which belongs to the serpin family. It is expressed by the liver and secreted in plasma. SERPINA10 / Serpin-A10 inhibits factor Xa activity in the presence of protein Z, calcium and phospholipid. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors).Over 1000 serpins have now been identified, these include 36 human proteins, as well as molecules in plants, fungi, bacteria, archaea and certain viruses. Serpins are the largest and most diverse family of protease inhibitors. Most serpins control proteolytic cascades, certain serpins do not inhibit enzymes, but instead perform diverse functions such as storage (ovalbumin, in egg white), hormone carriage proteins (thyroxine-binding globulin, cortisol-binding globulin) and tumor suppressor genes (maspin). Most inhibitory serpins target chymotrypsin-like serine proteases. These enzymes are defined by the presence of a nucleophilic serine residue in their catalytic site. Some serpins inhibit other classes of protease. A number of such serpins have been shown to target cysteine proteases. These enzymes differ from serine proteases in that they are defined by the presence of a nucleophilic cysteine residue, rather than a serine residue, in their catalytic site.

  • Han X, et al., 1998, Proc Natl Acad Sci. USA  95: 9250-5.
  • Han X, et al., 2000, Blood 96: 3049-55.
  • Irving JA, et al.,2000, Genome Res. 10 (12): 1845-64.
  • Irving J, et al.,2002, Mol Biol Evol. 19 (11): 1881-90.
  • Rawlings ND, et al.,2004, Biochem J. 378 (Pt 3): 705-16.
  • Water N, et al., 2004, Br J Haematol. 127:190-4.
  • Wei Z, et al., 2009, Blood 114 (17): 3662-7.
  • Whisstock JC, et al.,2010, J Biol Chem. 285 (32): 24307-12.
  • Size / Price
    Каталог: HG10992-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Human SERPINA10 ORF mammalian expression plasmid, C-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.