Быстрый заказ

Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SENP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC040609
    Размер кДНК:1770bp
    Описание кДНК:Full length Clone DNA of Homo sapiens SUMO1/sentrin/SMT3 specific peptidase 2 DNA.
    Синоним гена:AXAM2, SMT3IP2
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SENP2 qPCR primers for gene expression analysis, HP103830 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15204-ACGRBS16760
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15204-ACRRBS16760
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15204-ANGRBS16760
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15204-ANRRBS16760
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15204-CFRBS14710
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15204-CHRBS14710
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15204-CMRBS14710
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15204-CYRBS14710
    Человек SENP2 Джин клон кДНК в вектор клонированияHG15204-GRBS5130
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15204-NFRBS14710
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15204-NHRBS14710
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15204-NMRBS14710
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15204-NYRBS14710
    Человек SENP2 Джин ORF экспрессии кДНК клона плазмидыHG15204-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15204-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».