Быстрый заказ

Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SENP2 Информация о продукте «Клон cDNA»
Размер кДНК:1770bp
Описание кДНК:Full length Clone DNA of Homo sapiens SUMO1/sentrin/SMT3 specific peptidase 2 with N terminal HA tag.
Синоним гена:AXAM2, SMT3IP2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15204-ACGRBS16760
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15204-ACRRBS16760
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15204-ANGRBS16760
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15204-ANRRBS16760
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15204-CFRBS14710
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15204-CHRBS14710
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15204-CMRBS14710
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15204-CYRBS14710
Человек SENP2 Джин клон кДНК в вектор клонированияHG15204-GRBS5130
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15204-NFRBS14710
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15204-NHRBS14710
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15204-NMRBS14710
Человек SENP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15204-NYRBS14710
Человек SENP2 Джин ORF экспрессии кДНК клона плазмидыHG15204-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15204-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.