Быстрый заказ

Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды

  • Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
ПаспортОбзорыСвязанные продуктыПротоколы
Человек SEMA6A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020796.3
Размер кДНК:3093bp
Описание кДНК:Full length Clone DNA of Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A.
Синоним гена:VIA, SEMA, HT018, SEMAQ, SEMA6A1, KIAA1368, SEMA6A
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-SEMA6A
Участок рестрикции:KpnI + NotI (6.1kb + 3.09kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SEMA6A qPCR primers for gene expression analysis, HP101094 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек SEMA6A Gene Plasmid Map
Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11189-ACGRBS22240
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11189-ACRRBS22240
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11189-CFRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11189-CHRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11189-CMRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11189-CYRBS20190
Человек SEMA6A Джин клон кДНК в вектор клонированияHG11189-MRBS5130
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11189-M-FRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11189-NFRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11189-NHRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11189-NMRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11189-NYRBS20190
Человек SEMA6A Джин ORF экспрессии кДНК клона плазмидыHG11189-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Ссылки
  • Klostermann A., et al., 2000, J. Biol. Chem. 275:39647-53.
  • Nagase T., et al., 2000, DNA Res. 7:65-73.
  • Schmutz J., et al., 2004, Nature 431:268-74.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».