After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SEMA3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_006080.2
Размер кДНК:2316bp
Описание кДНК:Full length Clone DNA of Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A with N terminal His tag.
Синоним гена:SemD, SEMA1, SEMAD, SEMAL, coll-1, Hsema-I, SEMAIII, Hsema-III, MGC133243, SEMA3A
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10758-ACGRBS16760
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10758-ACRRBS16760
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10758-CFRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10758-CHRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10758-CMRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10758-CYRBS14710
Человек Semaphorin 3A/SEMA3A Джин клон кДНК в вектор клонированияHG10758-MRBS5130
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмидыHG10758-M-NRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10758-NFRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10758-NHRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10758-NMRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10758-NYRBS14710
Человек Semaphorin 3A/SEMA3A Джин ORF экспрессии кДНК клона плазмидыHG10758-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

Ссылки
  • Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.
  • Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.
  • Gu, C. et al., 2005, Science.307(5707): 265–268.
  • Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.
  • Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.
  • Size / Price
    Каталог: HG10758-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».