Быстрый заказ

Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SELPLG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003006.3
Размер кДНК:1209bp
Описание кДНК:Full length Clone DNA of Homo sapiens selectin P ligand with C terminal HA tag.
Синоним гена:CLA, CD162, PSGL1, PSGL-1, SELPLG
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10490-ACGRBS15400
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10490-ACRRBS15400
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10490-CFRBS13340
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10490-CHRBS13340
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10490-CMRBS13340
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10490-CYRBS13340
Человек PSGL-1/CD162 Джин клон кДНК в вектор клонированияHG10490-MRBS5130
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10490-NFRBS13340
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10490-NHRBS13340
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10490-NMRBS13340
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10490-NYRBS13340
Человек PSGL-1/CD162 Джин ORF экспрессии кДНК клона плазмидыHG10490-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

P-selectin glycoprotein ligand-1 (PSGL-1), also known as SELPLG or CD162, is the high affinitycounter-receptor for P-selectin on expressed on activated endothelial cells and platelets. PSGL-1 is a mucin-type glycoprotein, expressed on leukocytes and platelets as a homodimer of two disulfide-linked subunits of ~120 kD. As cell adhesion molecules, multiple studies have shown that PSGL-1/ P-selectin interaction is required for the normal recruitment of leukocytes during inflammatory reactions, and also participates in hemostatic responses. PSGL-1 protein requires two distinct posttranslational modifications for the Ca2+-dependent recognition by the lectin domain of P-selectin, that is tyrosine sulfation and specific O-linked glycosylation (sialic acid and fucose). PSGL-1 can also bind to other two members of the selectin family, E-selectin (endothelial) and L-selectin (leukocyte), but binds best to P-selectin.

Ссылки

1. Sako, D. et al., 1993, Cell. 75: 1179-1186.

2. Wilkins, P. P. et al., 1995, J. Biol. Chem. 270: 22677-22680.

3. Frenette, P. S. et al., 2000, J. Exp. Med. 191: 1413-1422.

4. Vandendries, E.R .et al., 2004, Thromb. Haemost. 92: 459-466..

5. Pouyani, T. et al., 1995, Cell. 83: 333-343.

Size / Price
Каталог: HG10490-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».