Быстрый заказ

Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SECISBP2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_024077.3
    Размер кДНК:2565bp
    Описание кДНК:Full length Clone DNA of Homo sapiens SECIS binding protein 2 with C terminal His tag.
    Синоним гена:SBP2, DKFZp686C09169, SECISBP2
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SECISBP2 qPCR primers for gene expression analysis, HP101039 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11127-ACGRBS22240
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11127-ACRRBS22240
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11127-ANGRBS22240
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11127-ANRRBS22240
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11127-CFRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11127-CHRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11127-CMRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11127-CYRBS20190
    Человек SECISBP2 Джин клон кДНК в вектор клонированияHG11127-MRBS5130
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11127-M-FRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11127-NFRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11127-NHRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11127-NMRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11127-NYRBS20190
    Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмидыHG11127-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG11127-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».