Быстрый заказ

Text Size:AAA

Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SECISBP2 Информация о продукте «Клон cDNA»
Размер кДНК:2565bp
Описание кДНК:Full length Clone DNA of Homo sapiens SECIS binding protein 2 with C terminal His tag.
Синоним гена:SBP2, DKFZp686C09169, SECISBP2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11127-ACGRBS22240
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11127-ACRRBS22240
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11127-ANGRBS22240
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11127-ANRRBS22240
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11127-CFRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11127-CHRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11127-CMRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11127-CYRBS20190
Человек SECISBP2 Джин клон кДНК в вектор клонированияHG11127-MRBS5130
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11127-M-FRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11127-NFRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11127-NHRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11127-NMRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11127-NYRBS20190
Человек SECISBP2 Джин ORF экспрессии кДНК клона плазмидыHG11127-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11127-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.