Syntenin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

Syntenin cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Human syndecan binding protein (syntenin) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Syntenin cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

MDA-9 cDNA ORF Clone, Human; MDA9 cDNA ORF Clone, Human; ST1 cDNA ORF Clone, Human; SYCL cDNA ORF Clone, Human; TACIP18 cDNA ORF Clone, Human

Syntenin Background Information

Syntenin1/SDCBP (syndecan binding protein), also known as melanoma differentiation associated gene-9 (MDA-9), is a PDZ domain-containing molecule, which was initially identified as a key oncogene in melanoma. IL-6 promotes glioma cell proliferation and invasion by inducing SDCBP expression, which is mediated by JAK2/STAT3 signaling. SDCBP might be an important marker for identifying Triple negative breast cancer (TNBC) cases that are suitable for dasatinib therapy.
Full Name
syndecan binding protein (syntenin)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait