After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SDC1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001006946.1
Размер кДНК:933bp
Описание кДНК:Full length Clone DNA of Homo sapiens syndecan 11 with N terminal Myc tag.
Синоним гена:SDC, CD138, SYND1, syndecan, SDC1
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-SDC1
Участок рестрикции:KpnI + XbaI (6kb + 0.96kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 279G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human SDC1 Gene Plasmid Map
Human SDC1 ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11429-ACGRBS15400
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11429-ACRRBS15400
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11429-CFRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11429-CHRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11429-CMRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11429-CYRBS13340
Человек SDC1 Gene cDNA clone plasmidHG11429-MRBS5130
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11429-M-HRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11429-NFRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11429-NHRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11429-NMRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11429-NYRBS13340
Человек Syndecan-1/CD138/SDC1 Джин ORF экспрессии кДНК клона плазмидыHG11429-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.

Ссылки
  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.
  • Size / Price
    Каталог: HG11429-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Human SDC1 ORF mammalian expression plasmid, N-Myc tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».