After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SCRN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC040492
Размер кДНК:1245bp
Описание кДНК:Full length Clone DNA of Homo sapiens secernin 1 with C terminal His tag.
Синоним гена:SES1
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15177-ACGRBS15400
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15177-ACRRBS15400
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15177-ANGRBS15400
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15177-ANRRBS15400
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15177-CFRBS13340
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15177-CHRBS13340
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15177-CMRBS13340
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15177-CYRBS13340
Человек SCRN1 Джин клон кДНК в вектор клонированияHG15177-GRBS5130
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15177-NFRBS13340
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15177-NHRBS13340
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15177-NMRBS13340
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15177-NYRBS13340
Человек SCRN1 Джин ORF экспрессии кДНК клона плазмидыHG15177-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15177-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».