Быстрый заказ

Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SCNN1D Информация о продукте «Клон cDNA»
Размер кДНК:1917bp
Описание кДНК:Full length Clone DNA of Homo sapiens sodium channel, non-voltage-gated 1, delta subunit with N terminal His tag.
Синоним гена:ENaCd, SCNED, dNaCh, ENaCdelta
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15974-ACGRBS16760
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15974-ACRRBS16760
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15974-CFRBS14710
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15974-CHRBS14710
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15974-CMRBS14710
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15974-CYRBS14710
Человек SCNN1D Джин клон кДНК в вектор клонированияHG15974-GRBS5130
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15974-NFRBS14710
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15974-NHRBS14710
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15974-NMRBS14710
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15974-NYRBS14710
Человек SCNN1D Джин ORF экспрессии кДНК клона плазмидыHG15974-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15974-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.