Быстрый заказ

Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек SCLY Информация о продукте «Клон cDNA»
    Размер кДНК:1338bp
    Описание кДНК:Full length Clone DNA of Homo sapiens selenocysteine lyase with N terminal Myc tag.
    Синоним гена:SCL, hSCL
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with SCLY qPCR primers for gene expression analysis, HP103534 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14905-ACGRBS15400
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14905-ACRRBS15400
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14905-ANGRBS15400
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14905-ANRRBS15400
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14905-CFRBS13340
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14905-CHRBS13340
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14905-CMRBS13340
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14905-CYRBS13340
    Человек SCLY / Selenocysteine Lyase Джин клон кДНК в вектор клонированияHG14905-GRBS5130
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14905-NFRBS13340
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14905-NHRBS13340
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14905-NMRBS13340
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14905-NYRBS13340
    Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмидыHG14905-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    SCLY, also known as selenocysteine lyase, belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family. It is a novel enzyme that exclusively decomposes L-selenocysteine into L-alanine and H2Se in various mammalian tissues. SCLY contains pyridoxal 5'-phosphate and weighs approximately 85,000. SCLY participates in selenoamino acid metabolism. It employs one cofactor, pyridoxal phosphate. Its maximum reactivity is at about pH 9.0. It was shown that 1 mol of selenocysteine is converted to equimolar amounts of alanine and H2Se. The following amino acids are insert: L-cysteine, L-serine, L-cysteine sulfinate, selenocysteamine, Se-ethyl-DL-selenocysteine, and L-selenohomocysteine. L-Cysteine (Ki, 1.0 mM) competes with L-selenocysteine (Km, 0.83mM) to inhibit the enzyme reaction.

  • Johansson AL. et al., 2012, PLoS One. 7 (1): e30528.
  • Collins R. et al., 2012, PLoS One. 7 (1): e30581.
  • N Esaki. et al., 1982, The Journal of Biological Chemistry. 257: 4386-91.
  • Size / Price
    Каталог: HG14905-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.