After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SCLY Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC007891
Размер кДНК:1338bp
Описание кДНК:Full length Clone DNA of Homo sapiens selenocysteine lyase with N terminal Myc tag.
Синоним гена:SCL, hSCL
Виды:Human
переносчик:pCMV3-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14905-ACGRBS15400
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14905-ACRRBS15400
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14905-ANGRBS15400
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14905-ANRRBS15400
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14905-CFRBS13340
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14905-CHRBS13340
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14905-CMRBS13340
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14905-CYRBS13340
Человек SCLY / Selenocysteine Lyase Джин клон кДНК в вектор клонированияHG14905-GRBS5130
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14905-NFRBS13340
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14905-NHRBS13340
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14905-NMRBS13340
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14905-NYRBS13340
Человек SCLY / Selenocysteine Lyase Джин ORF экспрессии кДНК клона плазмидыHG14905-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

SCLY, also known as selenocysteine lyase, belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family. It is a novel enzyme that exclusively decomposes L-selenocysteine into L-alanine and H2Se in various mammalian tissues. SCLY contains pyridoxal 5'-phosphate and weighs approximately 85,000. SCLY participates in selenoamino acid metabolism. It employs one cofactor, pyridoxal phosphate. Its maximum reactivity is at about pH 9.0. It was shown that 1 mol of selenocysteine is converted to equimolar amounts of alanine and H2Se. The following amino acids are insert: L-cysteine, L-serine, L-cysteine sulfinate, selenocysteamine, Se-ethyl-DL-selenocysteine, and L-selenohomocysteine. L-Cysteine (Ki, 1.0 mM) competes with L-selenocysteine (Km, 0.83mM) to inhibit the enzyme reaction.

Ссылки
  • Johansson AL. et al., 2012, PLoS One. 7 (1): e30528.
  • Collins R. et al., 2012, PLoS One. 7 (1): e30581.
  • N Esaki. et al., 1982, The Journal of Biological Chemistry. 257: 4386-91.
  • Size / Price
    Каталог: HG14905-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».