After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SCG2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC022509
Размер кДНК:1854bp
Описание кДНК:Full length Clone DNA of Homo sapiens secretogranin II (chromogranin C) with C terminal HA tag.
Синоним гена:SN, CHGC, SgII, SCG2
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13441-ACGRBS16760
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13441-ACRRBS16760
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13441-CFRBS14710
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13441-CHRBS14710
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13441-CMRBS14710
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13441-CYRBS14710
Человек SCG2 / Secretogranin II Джин клон кДНК в вектор клонированияHG13441-GRBS5130
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13441-NFRBS14710
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13441-NHRBS14710
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13441-NMRBS14710
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13441-NYRBS14710
Человек SCG2 / Secretogranin II Джин ORF экспрессии кДНК клона плазмидыHG13441-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Kit ligand, also known as Hematopoietic growth factor KL, Mast cell growth factor, Steel factor, Stem cell factor, c-Kit ligand, Kitlg and KITL, is a single-pass type I membrane protein which belongs to the SCF family. KITL / kit ligand also belongs to the family of dimeric transmembrane growth factors. The soluble form of KIT ligand is a secreted protein. Mast cells are thought to participate in a variety of immune responses, such as parasite resistance and the allergic reaction. Mast cell development depends on stem cell factor (Kit ligand) and its receptor, c-Kit. KITL / kit ligand stimulates the proliferation of mast cells. KITL / kit ligand is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. Efficient cell surface presentation of KITL / kit ligand is essential for the migration, proliferation, and survival of melanocytes, germ cells, hemopoietic stem cells, and mastocytes. KITL / kit ligand acts synergistically with other cytokines, probably interleukins. KITL / kit ligand plays a crucial role in the development and maintenance of the melanocyte lineage in adult skin. It exerts permanent survival, proliferation and migration functions in Kit receptor-expressing melanocytes. KITL / kit ligand misexpression in some hyperpigmented lesions may open the avenue for Kitl-dependent treatment of pathological skin conditions.

Ссылки
  • Nishida,K.et al., 2002, Blood. 99 (5):1866-9.
  • Paulhe,F. et al., 2004,J Biol Chem. 279 (53):55545-55.
  • Fernandez,S.M. et al., 2008,Biol Reprod. 79 (2):318-27.
  • Wehrle-Haller,B. et al., 2003,Pigment Cell Res.16 (3):287-96.
  • Size / Price
    Каталог: HG13441-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».