Быстрый заказ

Text Size:AAA

Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human KITLG Информация о продукте «Клон cDNA»
Размер кДНК:822bp
Описание кДНК:Full length Clone DNA of Homo sapiens KIT ligand with C terminal His tag.
Синоним гена:SF, MGF, SCF, KL-1, Kitl, SHEP7, DKFZp686F2250, KITLG
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10451-ACGRBS15400
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10451-ACRRBS15400
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10451-CFRBS13340
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10451-CHRBS13340
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10451-CMRBS13340
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10451-CYRBS13340
Человек KITLG/SCF/C-kit ligand Джин клон кДНК в вектор клонированияHG10451-MRBS5130
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10451-NFRBS13340
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10451-NHRBS13340
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10451-NMRBS13340
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10451-NYRBS13340
Человек KITLG/SCF/C-kit ligand Джин ORF экспрессии кДНК клона плазмидыHG10451-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Similar to Kit ligand precursor (C-kit ligand) , also known as Stem cell factor (SCF), Mast cell growth factor (MGF) or Hematopoietic growth factor KL. SCF/C-kit ligand is the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. SCF/C-kit ligand stimulates the proliferation of mast cells. This protein is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. It may act synergistically with other cytokines, probably interleukins SCF/C-kit ligand is the ligand for the tyrosine kinase receptor c-kit, which is expressed on both primitive and mature hematopoietic progenitor cells. In vitro, SCF/C-kit ligand synergizes with other growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage- colony- stimulating factor, and interleukin-3 to stimulate the proliferation and differentiation of cells of the lymphoid, myeloid, erythroid, and megakaryocytic lineages. In vivo, SCF/C-kit also synergizes with other growth factors and has been shown to enhance the mobilization of peripheral blood progenitor cells in combination with G-CSF. In phase I/II clinical studies administration of the combination of SCF and G-CSF resulted in a two- to threefold increase in cells that express the CD34 antigen compared with G-CSF alone.

  • McNiece IK, et al. (1995) Stem cell factor. J Leukoc Biol. 58(1): 14-22.
  • Besmer P, et al. (1993) The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-37.
  • Mekori YA, et al. (1993) IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol. 151(7): 3775-84.
  • Size / Price
    Каталог: HG10451-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.