SAE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

SAE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Human SUMO1 activating enzyme subunit 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SAE1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

AOS1 cDNA ORF Clone, Human; HSPC140 cDNA ORF Clone, Human; SUA1 cDNA ORF Clone, Human; UBLE1A cDNA ORF Clone, Human

SAE1 Background Information

SAE1 belongs to the ubiquitin-activating E1 family. It is a heterodimer that acts as a E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It functions as a UBLI E1 ligase mediating the ATP-dependent activation of UBL1. SAE1 binds with UBLE1A and UBLE1B to form a heterodimer which can bind UBL1. SAE1 also regulates ATP-dependent activation of SUMO proteins and formation of a thioester with a conserved cysteine residue on SAE2. SAE1 and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins.
Full Name
SUMO1 activating enzyme subunit 1
References
  • Gong L, et al. (1999) Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett. 448(1):185-9.
  • Lois LM, et al. (2005) Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to E1. EMBO J. 24(3):439-51.
  • Tatham MH, et al. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem. 276(38):35368-74.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait