Быстрый заказ

Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human SAE1 Информация о продукте «Клон cDNA»
Размер кДНК:1041bp
Описание кДНК:Full length Clone DNA of Homo sapiens SUMO1 activating enzyme subunit 1 with C terminal Flag tag.
Синоним гена:AOS1, SUA1, UBLE1A, HSPC140
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13921-ACGRBS15400
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13921-ACRRBS15400
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13921-ANGRBS15400
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13921-ANRRBS15400
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13921-CFRBS13340
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13921-CHRBS13340
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13921-CMRBS13340
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13921-CYRBS13340
Человек SAE1 Джин клон кДНК в вектор клонированияHG13921-GRBS5130
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13921-NFRBS13340
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13921-NHRBS13340
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13921-NMRBS13340
Человек SAE1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13921-NYRBS13340
Человек SAE1 Джин ORF экспрессии кДНК клона плазмидыHG13921-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

SAE1 belongs to the ubiquitin-activating E1 family. It is a heterodimer that acts as a E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It functions as a UBLI E1 ligase mediating the ATP-dependent activation of UBL1. SAE1 binds with UBLE1A and UBLE1B to form a heterodimer which can bind UBL1. SAE1 also regulates ATP-dependent activation of SUMO proteins and formation of a thioester with a conserved cysteine residue on SAE2. SAE1 and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins.

  • Gong L, et al. (1999) Molecular cloning and characterization of human AOS1 and UBA2, components of the sentrin-activating enzyme complex. FEBS Lett. 448(1):185-9.
  • Lois LM, et al. (2005) Structures of the SUMO E1 provide mechanistic insights into SUMO activation and E2 recruitment to E1. EMBO J. 24(3):439-51.
  • Tatham MH, et al. (2001) Polymeric chains of SUMO-2 and SUMO-3 are conjugated to protein substrates by SAE1/SAE2 and Ubc9. J Biol Chem. 276(38):35368-74.
  • Size / Price
    Каталог: HG13921-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.