Быстрый заказ

Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек RPS6KB1 Информация о продукте «Клон cDNA»
    Размер кДНК:1578bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal His tag.
    Синоним гена:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with RPS6KB1 qPCR primers for gene expression analysis, HP100180 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10099-ACGRBS16760
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10099-ACRRBS16760
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10099-ANGRBS16760
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10099-ANRRBS16760
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10099-CFRBS14710
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10099-CHRBS14710
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10099-CMRBS14710
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10099-CYRBS14710
    Человек PS6K / RPS6KB1 Джин клон кДНК в вектор клонированияHG10099-MRBS5130
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10099-NFRBS14710
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10099-NHRBS14710
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10099-NMRBS14710
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10099-NYRBS14710
    Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмидыHG10099-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • Size / Price
    Каталог: HG10099-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.