After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RPS6KB1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003161.2
Размер кДНК:1578bp
Описание кДНК:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal His tag.
Синоним гена:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10099-ACGRBS16760
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10099-ACRRBS16760
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10099-ANGRBS16760
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10099-ANRRBS16760
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10099-CFRBS14710
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10099-CHRBS14710
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10099-CMRBS14710
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10099-CYRBS14710
Человек PS6K / RPS6KB1 Джин клон кДНК в вектор клонированияHG10099-MRBS5130
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10099-NFRBS14710
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10099-NHRBS14710
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10099-NMRBS14710
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10099-NYRBS14710
Человек PS6K / RPS6KB1 Джин ORF экспрессии кДНК клона плазмидыHG10099-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

Ссылки
  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • Size / Price
    Каталог: HG10099-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».