Быстрый заказ

Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human S1PR2 Информация о продукте «Клон cDNA»
Размер кДНК:1062bp
Описание кДНК:Full length Clone DNA of Homo sapiens sphingosine-1-phosphate receptor 2 with N terminal Myc tag.
Синоним гена:EDG5, H218, LPB2, S1P2, AGR16, EDG-5, Gpcr13, S1PR2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13112-ACGRBS15400
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13112-ACRRBS15400
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13112-CFRBS13340
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13112-CHRBS13340
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13112-CMRBS13340
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13112-CYRBS13340
Человек S1PR2 Джин клон кДНК в вектор клонированияHG13112-GRBS5130
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13112-NFRBS13340
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13112-NHRBS13340
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13112-NMRBS13340
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13112-NYRBS13340
Человек S1PR2 Джин ORF экспрессии кДНК клона плазмидыHG13112-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13112-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.