After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Human S1PR1 ORF mammalian expression plasmid, N-His tag

ПаспортОбзорыСвязанные продуктыПротоколы
Human S1PR1 Информация о продукте «Клон cDNA»
Размер кДНК:1149bp
Описание кДНК:Full length Clone DNA of Homo sapiens sphingosine-1-phosphate receptor 1 with N terminal His tag.
Синоним гена:EDG1, S1P1, CD363, ECGF1, EDG-1, CHEDG1, D1S3362
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Каталог: HG12413-NH
Цена по прейскуранту:   (Save )
Цена:      [How to order]
 Инструкции по доставке
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.