After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human S100A9 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002965.3
Размер кДНК:345bp
Описание кДНК:Full length Clone DNA of Homo sapiens S100 calcium binding protein A9 with C terminal HA tag.
Синоним гена:MIF, NIF, P14, CAGB, CFAG, CGLB, L1AG, LIAG, MRP14, 60B8AG, MAC387, S100A9
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11145-ACGRBS15400
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11145-ACRRBS15400
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11145-ANGRBS15400
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11145-CFRBS13340
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11145-CHRBS13340
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11145-CMRBS13340
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11145-CYRBS13340
Человек S100A9/MRP-14 Джин клон кДНК в вектор клонированияHG11145-MRBS5130
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11145-NFRBS13340
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11145-NHRBS13340
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11145-NMRBS13340
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11145-NYRBS13340
Человек S100A9/MRP-14 Джин ORF экспрессии кДНК клона плазмидыHG11145-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. Protein S100-A9, also known as S100 calcium-binding protein A9, S100A9, and CAGB, is a member of the S-100 family. S100A9 is expressed by macrophages in acutely inflammed tissues and in chronic inflammation. It is also expressed in epithelial cells constitutively or induced during dermatoses. S100A9 is a calcium-binding protein. It has anti-microbial activity towards bacteria and fungi. The anti-microbial and proapoptotic activity of S100A9 is inhibited by zinc ions. S100A9 plays a role in the development of endotoxic shock in response to bacterial lipopolysaccharide (LPS). It promotes tubulin polymerization when unphosphorylated. It also promotes phagocyte migration and infiltration of granulocytes at sites of wounding. S100A9 plays a role as a pro-inflammatory mediator in acute and chronic inflammation and up-regulates the release of IL8 and cell-surface expression of ICAM1.

Ссылки
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Fanò G. et al., 1995, Prog Neurobiol. 46 (1): 71-82.
  • Vogl T. et al., 2004, Blood. 104: 4260-8.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • Size / Price
    Каталог: HG11145-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».