S100A8 cDNA ORF Clone, Human, C-HA tag

1/1
Price:
Size:
Number:

S100A8 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
282 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A8 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.32kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

S100A8 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A8 cDNA ORF Clone, Human, C-HA tag: Validated Images

S100A8 cDNA ORF Clone, Human, C-HA tag: Alternative Names

60B8AG cDNA ORF Clone, Human; CAGA cDNA ORF Clone, Human; CFAG cDNA ORF Clone, Human; CGLA cDNA ORF Clone, Human; CP-10 cDNA ORF Clone, Human; L1Ag cDNA ORF Clone, Human; MA387 cDNA ORF Clone, Human; MIF cDNA ORF Clone, Human; MRP-8 cDNA ORF Clone, Human; MRP8 cDNA ORF Clone, Human; NIF cDNA ORF Clone, Human; P8 cDNA ORF Clone, Human

S100A8 Background Information

S1A8 is a member of the S1 protein family containing 2EF-hand calcium-binding motifs. S1 proteins are involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. Altered expression of S1A8 protein is associated with various diseases and cancers. S1A8 may have an immunoregulatory role by contributing to the regulation of fetal-maternal interactions. It may play a protective role and its absence may allow infiltration by maternal cells, a process eventually manifesting as resorption. The heterodimeric S1 protein complex S1A8/A9 which has been shown to be involved in inflammatory and neoplastic disorders. The complex can induce cell proliferation, or apoptosis, inflammation, collagen synthesis, and cell migration. S1A8/A9 has emerged as important pro-inflammatory mediator in acute and chronic inflammation. More recently, increased S1A8 and S1A9 levels were also detected in various human cancers, presenting abundant expression in neoplastic tumor cells as well as infiltrating immune cells. On the one hand, S1A8/A9 is a powerful apoptotic agent produced by immune cells, making it a very fascinating tool in the battle against cancer. It spears the risk to induce auto-immune response and may serve as a lead compound for cancer-selective therapeutics. In contrast, S1A8/A9 expression in cancer cells has also been associated with tumor development, cancer invasion or metastasis. Altogether, its expression and potential cytokine-like function in inflammation and in cancer suggests that S1A8/A9 may play a key role in inflammation-associated cancer.
Full Name
S100 calcium binding protein A8
References
  • Passey RJ, et al. (1999) S100A8: emerging functions and regulation. J Leukoc Biol. 66(4): 549-56.
  • Gebhardt C, et al. (2006) S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol. 72(11): 1622-31.
  • Halayko AJ, et al. (2009) S100A8/A9: a mediator of severe asthma pathogenesis and morbidity? Can J Physiol Pharmacol. 87(10): 743-55.
  • Ghavami S, et al. (2009) S100A8/A9: a Janus-faced molecule in cancer therapy and tumorgenesis. Eur J Pharmacol. 625(1-3): 73-83.
  • Ha YS, et al. (2010) mRNA Expression of S100A8 as a Prognostic Marker for Progression of Non-Muscle-Invasive Bladder Cancer. Korean J Urol. 51(1): 15-20.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait