Быстрый заказ

Text Size:AAA

Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human S100A7 Информация о продукте «Клон cDNA»
Размер кДНК:306bp
Описание кДНК:Full length Clone DNA of Homo sapiens S100 calcium binding protein A7 with C terminal HA tag.
Синоним гена:PSOR1, S100A7c, S100A7
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11141-ACGRBS15400
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11141-ACRRBS15400
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11141-ANGRBS15400
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11141-ANRRBS15400
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11141-CFRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11141-CHRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11141-CMRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11141-CYRBS13340
Человек S100A7 Джин клон кДНК в вектор клонированияHG11141-MRBS5130
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11141-M-FRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11141-NFRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11141-NHRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11141-NMRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11141-NYRBS13340
Человек S100A7 Джин ORF экспрессии кДНК клона плазмидыHG11141-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Protein S100-A7, also known as S100 calcium-binding protein A7, Psoriasin, S100A7, and PSOR1, is a secreted protein which belongs to the S-100 family. S100A7 was first isolated from skin involved by psoriasis, which can be induced in cultured squamous epithelial cells. S100A7 is expressed by both normal cultured and malignant keratinocytes and malignant breast epithelial cells within ductal carcinoma in situ, suggesting an association with abnormal pathways of differentiation. S100A7 plays a role in the pathogenesis of inflammatory skin disease, as a chemotactic factor for hematopoietic cells. It also plays a role in early stages of breast tumor progression in association with the development of the invasive phenotype.

  • Miyasaki, KT. et al., 1993, J. Dent. Res. 72: 517-23.
  • Watson, PH. et al., 1998, Int J Biochem Cell Biol  30 (5):567-71.
  • Emberley, ED. et al., 2004, Breast Cancer Res  6 (4): 153-9.
  • Ohuchida, K. et al., 2006, Clin Cancer Res  12 (18):5417-22.
  • Kouno, T. et al., 2008, J Pept Sci. 14 (10):1129-38.
  • León, R. et al., 2009, Biochemistry. 48 (44): 10591-600.
  • Size / Price
    Каталог: HG11141-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.