Быстрый заказ

Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек S100A5 Информация о продукте «Клон cDNA»
    Размер кДНК:333bp
    Описание кДНК:Full length Clone DNA of Homo sapiens S100 calcium binding protein A5 with C terminal HA tag.
    Синоним гена:S100D, S100A5
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with S100A5 qPCR primers for gene expression analysis, HP101052 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11142-ACGRBS15400
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11142-ACRRBS15400
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11142-ANGRBS15400
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11142-ANRRBS15400
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11142-CFRBS13340
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11142-CHRBS13340
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11142-CMRBS13340
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11142-CYRBS13340
    Человек S100A5 Джин клон кДНК в вектор клонированияHG11142-MRBS5130
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11142-NFRBS13340
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11142-NHRBS13340
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11142-NMRBS13340
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11142-NYRBS13340
    Человек S100A5 Джин ORF экспрессии кДНК клона плазмидыHG11142-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    S100 protein?is a family of low molecular weight protein found in vertebrates characterized by two?EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is?100%?soluble in ammonium sulfate?at neutral?pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the?neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.?? Protein S100-A5, also known as Protein S-100D, S100 calcium-binding protein A5, S100A5 and S100D, is a member of the S100 family which contains two?EF-hand domains. S100A5 is also a novel member of the EF-hand superfamily of calcium-binding proteins that is poorly characterized at the protein level. It is expressed in very restricted regions of the adult brain. From birth onwards, S100A5 remained a neuronal-specific protein, only located in a subpopulation of neurons in the spiral ganglion.

  • Sch?fer,B.W. et al., 2000, J Biol Chem. 275 (39):30623-30.
  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008, J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.