S100A3 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

S100A3 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
306 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

S100A3 cDNA ORF Clone, Human, C-HA tag: Alternative Names

S100E cDNA ORF Clone, Human

S100A3 Background Information

Protein S1-A3, also known as Protein S-1E, S1 calcium-binding protein A3, S1A3 and S1E, is a member of the S-1 family. S1A3 / S1E contains 2EF-hand domains. S1A3 / S1E is highly expressed in the differentiating cuticular cells within the hair follicle and organized into mature hair cuticles. High concentrations of S1A3 homotetramer might provide the millimolar level of Ca2+ required for hair cuticular barrier formation. S1A3 / S1E is a unique member of the Ca2+-binding S1 protein family with the highest cysteine content and affinity for Zn2+. S1A3 / S1E binds both calcium and zinc. S1A3 / S1E probably binds 2 zinc ions per molecule. It may be involved in calcium-dependent cuticle cell differentiation and hair shaft formation. S1A3 plays an important role in calcium-dependent processes leading to hair shaft formation. S1A3 / S1E is a unique protein among all members of the calcium-binding S1 family, is specifically expressed at the inner endocuticle of human hair fibers. Upon hair damage, S1A3 / S1E is released from hair fibers and possibly destabilizes the hair tissue architecture.
Full Name
S100 calcium binding protein A3
References
  • Kizawa, K. et al., 2008, J Biol Chem. 283 (8):5004-13.
  • Kizawa, K. et al., 1998, J Invest Dermatol. 111 (5):879-86.
  • Kizawa, K. et al., 2002, Biochem Biophys Res Commun. 299 (5):857-62.
  • Fritz,G. et al., 2002, J Biol Chem. 277 (36):33092-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait