After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human S100A3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002960.1
Размер кДНК:306bp
Описание кДНК:Full length Clone DNA of Homo sapiens S100 calcium binding protein A3 with C terminal HA tag.
Синоним гена:S100E, S100A3
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11136-ACGRBS15396
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11136-ACRRBS15396
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11136-ANGRBS15396
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11136-ANRRBS15396
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11136-CFRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11136-CHRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11136-CMRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11136-CYRBS13343
Человек S100A3 Джин клон кДНК в вектор клонированияHG11136-MRBS5132
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11136-M-FRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11136-NFRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11136-NHRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11136-NMRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11136-NYRBS13343
Человек S100A3 Джин ORF экспрессии кДНК клона плазмидыHG11136-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Protein S100-A3, also known as Protein S-100E, S100 calcium-binding protein A3, S100A3 and S100E, is a member of the S-100 family. S100A3 / S100E contains 2 EF-hand domains. S100A3 / S100E is highly expressed in the differentiating cuticular cells within the hair follicle and organized into mature hair cuticles. High concentrations of S100A3 homotetramer might provide the millimolar level of Ca2+ required for hair cuticular barrier formation. S100A3 / S100E is a unique member of the Ca2+-binding S100 protein family with the highest cysteine content and affinity for Zn2+. S100A3 / S100E binds both calcium and zinc. S100A3 / S100E probably binds 2 zinc ions per molecule. It may be involved in calcium-dependent cuticle cell differentiation and hair shaft formation. S100A3 plays an important role in calcium-dependent processes leading to hair shaft formation. S100A3 / S100E is a unique protein among all members of the calcium-binding S100 family, is specifically expressed at the inner endocuticle of human hair fibers. Upon hair damage, S100A3 / S100E is released from hair fibers and possibly destabilizes the hair tissue architecture.

Ссылки
  • Kizawa, K. et al., 2008, J Biol Chem. 283 (8):5004-13.
  • Kizawa, K. et al., 1998, J Invest Dermatol. 111 (5):879-86.
  • Kizawa, K. et al., 2002, Biochem Biophys Res Commun. 299 (5):857-62.
  • Fritz,G. et al., 2002, J Biol Chem. 277 (36):33092-8.
  • Size / Price
    Каталог: HG11136-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».