S100A16 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

S100A16 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
312 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A16 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

S100A16 cDNA ORF Clone, Human, C-HA tag: Alternative Names

AAG13 cDNA ORF Clone, Human; DT1P1A7 cDNA ORF Clone, Human; MGC17528 cDNA ORF Clone, Human; S100F cDNA ORF Clone, Human

S100A16 Background Information

S1A16 is a member of S1 protein super family that carries calcium-binding EF-hand motifs. S1 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S1A16 expression was found to be astrocyte-specific. The S1A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S1A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S1A16 was also calculated in the calcium(II)-bound form. Differently from most S1 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S1A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S1A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S1A16 protein is a novel adipogenesis-promoting factor.
Full Name
S100 calcium binding protein A16
References
  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait