Быстрый заказ

Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human S100A16 Информация о продукте «Клон cDNA»
Размер кДНК:312bp
Описание кДНК:Full length Clone DNA of Homo sapiens S100 calcium binding protein A16 with C terminal HA tag.
Синоним гена:AAG13, S100F, DT1P1A7, MGC17528, S100A16
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11137-ACGRBS15400
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11137-ACRRBS15400
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11137-ANGRBS15400
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11137-ANRRBS15400
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11137-CFRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11137-CHRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11137-CMRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11137-CYRBS13340
Человек S100A16 Джин клон кДНК в вектор клонированияHG11137-MRBS5130
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11137-M-FRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11137-NFRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11137-NHRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11137-NMRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11137-NYRBS13340
Человек S100A16 Джин ORF экспрессии кДНК клона плазмидыHG11137-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

S100A16 is a member of S100 protein super family that carries calcium-binding EF-hand motifs. S100 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S100A16 expression was found to be astrocyte-specific. The S100A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S100A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S100A16 was also calculated in the calcium(II)-bound form. Differently from most S100 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S100A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S100A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S100A16 protein is a novel adipogenesis-promoting factor.

  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
  • Size / Price
    Каталог: HG11137-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.