S100A11 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

S100A11 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
318 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A11 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

S100A11 cDNA ORF Clone, Human, C-HA tag: Alternative Names

HEL-S-43 cDNA ORF Clone, Human; MLN70 cDNA ORF Clone, Human; S100C cDNA ORF Clone, Human

S100A11 Background Information

Protein S1-A11, also known as S1 calcium-binding protein A11, S1A11 and MLN7, is a member of theS-1 family. S1A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S1A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S1A11 would trigger conformational changes which would expose the hydrophobic cleft of S1A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S1A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S1A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S1A11 is also a novel diagnostic marker in breast carcinoma.
Full Name
S100 calcium binding protein A11
References
  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait