Быстрый заказ

Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human S100A11 Информация о продукте «Клон cDNA»
Размер кДНК:318bp
Описание кДНК:Full length Clone DNA of Homo sapiens S100 calcium binding protein A11 with C terminal HA tag.
Синоним гена:MLN70, S100C, S100A11
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11140-ACGRBS15400
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11140-ACRRBS15400
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11140-ANGRBS15400
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11140-ANRRBS15400
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11140-CFRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11140-CHRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11140-CMRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11140-CYRBS13340
Человек S100A11 / S100C Джин клон кДНК в вектор клонированияHG11140-MRBS5130
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11140-M-FRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11140-NFRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11140-NHRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11140-NMRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11140-NYRBS13340
Человек S100A11 / S100C Джин ORF экспрессии кДНК клона плазмидыHG11140-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Protein S100-A11, also known as S100 calcium-binding protein A11, S100A11 and MLN70, is a member of the S-100 family. S100A11 is widely expressed in multiple tissues, and is located in cytoplasm, nucleus, and even cell periphery. S100A11 exists as a non-covalent homodimer with an antiparallel conformation. Ca(2+) binding to S100A11 would trigger conformational changes which would expose the hydrophobic cleft of S100A11 and facilitate its interaction with target proteins. As a dual cell growth mediator, S100A11 acts as either a tumor suppressor or promoter in many different types of tumors and would play respective roles in influencing the proliferation of the cancer cells. In the nucleus, S100A11 suppresses the growth of keratinocytes through p21 (CIP1/WAF1) activation and induces cell differentiation. S100A11 is also a novel diagnostic marker in breast carcinoma.

  • Miyasaki KT. et al., 1993, J Dent Res. 72: 517-23.
  • Ohuchida K. et al., 2006, Clin Cancer Res  12 (18): 5417-22.
  • Kouno T. et al., 2008, J Pept Sci. 14 (10): 1129-38.
  • He H. et al., 2009, Cell Biochem Biophys 55 (3): 117-26.
  • Liu XG. et al., 2010, Oncol Rep. 23 (5): 1301-8.
  • Size / Price
    Каталог: HG11140-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.