After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RAF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002880.3
Размер кДНК:1947bp
Описание кДНК:Full length Clone DNA of Homo sapiens v-raf-1 murine leukemia viral oncogene homolog 1.
Синоним гена:NS5, CRAF, Raf-1, c-Raf
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-RAF1
Участок рестрикции:KpnI + XbaI (6.1kb + 1.95kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human RAF1 Gene Plasmid Map
Human Raf-1 natural ORF mammalian expression plasmid
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10657-ACGRBS16760
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10657-ACRRBS16760
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10657-ANGRBS16764
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10657-ANRRBS16760
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10657-CFRBS14710
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10657-CHRBS14711
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10657-CMRBS14711
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10657-CYRBS14711
Человек Raf-1/RAF1 Джин клон кДНК в вектор клонированияHG10657-MRBS5132
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10657-NFRBS14711
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10657-NHRBS14711
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10657-NMRBS14710
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10657-NYRBS14711
Человек Raf-1/RAF1 Джин ORF экспрессии кДНК клона плазмидыHG10657-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10657-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human Raf-1 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».