Быстрый заказ

Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RTN4R Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_023004.5
Размер кДНК:1422bp
Описание кДНК:Full length Clone DNA of Homo sapiens reticulon 4 receptor with C terminal His tag.
Синоним гена:NGR, NOGOR, RTN4R
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10466-ACGRBS15400
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10466-ACRRBS15400
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10466-CFRBS13340
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10466-CHRBS13340
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10466-CMRBS13340
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10466-CYRBS13340
Человек Nogo Receptor Джин клон кДНК в вектор клонированияHG10466-MRBS5130
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10466-NFRBS13340
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10466-NHRBS13340
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10466-NMRBS13340
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10466-NYRBS13340
Человек Nogo Receptor Джин ORF экспрессии кДНК клона плазмидыHG10466-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Reticulon 4 receptor (RTN4R), also known as Nogo-66 Receptor (NgR), is a glycosylphosphoinositol (GPI)-anchored protein that belongs to the Nogo recptor family including three members. Mouse RTN4R cDNA contains 10 LRP (Leucine-rich) repeats. RTN4R is expressed predominantly in neurons and their axons in the central nervous systems (CNS). As a receptor for myelin-derived proteins Nogo, myelin-associated glycoprotein (MAG), and myelin oligodendrocyte glycoprotein (OMG), RTN4R mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult CNS. It has been shown that RTN4R performs its inhibitory actions by interacting with the p75 neurotrophin receptor (p75NTR), a TNFRSF member also known for modulating the activities of the Trk family and for inducing apoptosis in neurons and oligodendrocytes. RTN4R may be proposed as a potential drug target for treatment of various neurological conditions such as spinal cord injury, CNS lesions, peripheral nerve injury, stroke and Alzheimer's disease (AD). Additionally, RTN4R may play a role in regulating the function of the gap junctions.

Ссылки

1. Wang, X. et al., 2006, Ann Neurol. 60(5): 540-549.      

2. Wang, Y.Z. et al., 2006, Neuroreport.17(6):605-609.       

3. Zhu, H.Y. et al., 2007, Hum Pathol. 38(3): 426-434.           

4. David, S. et al., 2008, Trends Neurosci. 31(5): 221-226.       

5. Jiang, W. et al., 2009, Transl Res. 154(1): 40-48.      

6. Zhang, L. et al., 2009, J Neurosci, 9(19): 6348-6352.

Size / Price
Каталог: HG10466-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».