After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RTDR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC008986
Размер кДНК:1047bp
Описание кДНК:Full length Clone DNA of Homo sapiens rhabdoid tumor deletion region gene 1.
Синоним гена:MGC16968, RTDR1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14214-ACGRBS15400
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14214-ACRRBS15400
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14214-ANGRBS15400
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14214-ANRRBS15400
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14214-CFRBS13340
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14214-CHRBS13340
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14214-CMRBS13340
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14214-CYRBS13340
Человек RTDR1 Джин клон кДНК в вектор клонированияHG14214-GRBS5130
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14214-NFRBS13340
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14214-NHRBS13340
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14214-NMRBS13340
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14214-NYRBS13340
Человек RTDR1 Джин ORF экспрессии кДНК клона плазмидыHG14214-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14214-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».