After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RSPO3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_032784.3
Размер кДНК:819bp
Описание кДНК:Full length Clone DNA of Homo sapiens R-spondin 3 homolog (Xenopus laevis).
Синоним гена:PWTSR, THSD2, CRISTIN1, FLJ14440, RSPO3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-RSPO3
Участок рестрикции:KpnI + XbaI (6.1kb + 0.82kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutation 567 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11185-ACGRBS15400
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11185-ACRRBS15400
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11185-CFRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11185-CHRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11185-CMRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11185-CYRBS13340
Человек RSPO3 Джин клон кДНК в вектор клонированияHG11185-MRBS5130
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11185-M-FRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11185-NFRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11185-NHRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11185-NMRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11185-NYRBS13340
Человек RSPO3 Джин ORF экспрессии кДНК клона плазмидыHG11185-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

R-spondin 3 (RSPO3) is a member of the R-Spondin (RSPO) family in vertebrates that activate Wnt/beta-catenin signaling, plays a key role in these processes. The RSPO family of secreted Wnt modulators is involved in development and disease and holds therapeutic promise as stem cell growth factors. The four members have high structural homology. RSPO2 and RSPO3 are more potent than RSPO1, whereas RSPO4 is relatively inactive. All RSPO members require Wnt ligands and LRP6 for activity and amplify signaling of Wnt3A, Wnt1, and Wnt7A, suggesting that RSPO proteins are general regulators of canonical Wnt signaling. RSPO3/PCP signaling during gastrulation requires Wnt5a and is transduced via Fz7, Dvl, and JNK. RSPO3 functions by inducing Sdc4-dependent, clathrin-mediated endocytosis. RSPO3 is a novel, evolutionarily conserved angiogenic factor in embryogenesis. RSPO3 has a key role in the interaction between chorion and allantois in labyrinthine development.

Ссылки
  • Aoki M, et al. (2007) R-spondin3 is required for mouse placental development. Dev Biol. 301(1): 218-26.
  • Kazanskaya O, et al. (2008) The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development. 135(22): 3655-64.
  • Kim KA, et al. (2008) R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 19(6): 2588-96.
  • Ohkawara B, et al. (2011) Rspo3 Binds Syndecan 4 and Induces Wnt/PCP Signaling via Clathrin-Mediated Endocytosis to Promote Morphogenesis. Dev Cell. 20(3): 303-14.
  • Size / Price
    Каталог: HG11185-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».