After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RSPO2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_178565.4
Размер кДНК:732bp
Описание кДНК:Full length Clone DNA of Homo sapiens R-spondin 2 homolog (Xenopus laevis) with N terminal Myc tag.
Синоним гена:CRISTIN2, MGC35555, MGC43342, RSPO2
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13084-ACGRBS15400
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13084-ACRRBS15400
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13084-CFRBS13340
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13084-CHRBS13340
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13084-CMRBS13340
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13084-CYRBS13340
Человек FTLS / RSPO2 Джин клон кДНК в вектор клонированияHG13084-GRBS5130
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13084-NFRBS13340
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13084-NHRBS13340
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13084-NMRBS13340
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13084-NYRBS13340
Человек FTLS / RSPO2 Джин ORF экспрессии кДНК клона плазмидыHG13084-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.

Ссылки
  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • Size / Price
    Каталог: HG13084-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».