Быстрый заказ

Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RRM1 Информация о продукте «Клон cDNA»
Размер кДНК:2379bp
Описание кДНК:Full length Clone DNA of Homo sapiens ribonucleotide reductase M1 with N terminal Myc tag.
Синоним гена:R1, RIR1, RR1, RRM1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14316-ACGRBS16760
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14316-ACRRBS16760
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14316-ANGRBS16760
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14316-ANRRBS16760
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14316-CFRBS14710
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14316-CHRBS14710
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14316-CMRBS14710
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14316-CYRBS14710
Человек RRM1 Джин клон кДНК в вектор клонированияHG14316-GRBS5130
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14316-NFRBS14710
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14316-NHRBS14710
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14316-NMRBS14710
Человек RRM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14316-NYRBS14710
Человек RRM1 Джин ORF экспрессии кДНК клона плазмидыHG14316-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

RRM1 is a subunit of ribonucleoside-diphosphate reductase which is constituted by two subunits. Ribonucleoside-diphosphate reductase is an enzyme essential for the production of deoxyribonucleotides prior to DNA synthesis in S phase of dividing cells. RRM1 is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. RRM1 may play a role in malignancies and disease that involve this region.

  • Pitterle DM, et al. (1999) Human gene for the large subunit of ribonucleotide reductase (RRM1): functional analysis of the promoter. Genomics. 27(2):280-5.
  • Parker NJ, et al. (1995) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gautam A, et al. (2003) RRM1-induced metastasis suppression through PTEN-regulated pathways. Oncogene. 22(14):2135-42.
  • Size / Price
    Каталог: HG14316-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.