Быстрый заказ

Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек RPS9 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001013.3
    Размер кДНК:585bp
    Описание кДНК:Full length Clone DNA of Homo sapiens ribosomal protein S9 with C terminal His tag.
    Синоним гена:S9
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPS9 qPCR primers for gene expression analysis, HP105094 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16341-ACGRBS15400
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16341-ACRRBS15400
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16341-ANGRBS15400
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16341-ANRRBS15400
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16341-CFRBS13340
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16341-CHRBS13340
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16341-CMRBS13340
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16341-CYRBS13340
    Человек RPS9 Джин клон кДНК в вектор клонированияHG16341-GRBS5130
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16341-NFRBS13340
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16341-NHRBS13340
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16341-NMRBS13340
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16341-NYRBS13340
    Человек RPS9 Джин ORF экспрессии кДНК клона плазмидыHG16341-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».