Быстрый заказ

Text Size:AAA

Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human RPS6KA6 Информация о продукте «Клон cDNA»
Размер кДНК:2238bp
Описание кДНК:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 6 (RPS6KA6) with N terminal Myc tag.
Синоним гена:RPS6KA6, RSK4
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10147-ACGRBS16760
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10147-ACRRBS16760
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10147-ANGRBS16760
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10147-ANRRBS16760
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10147-CFRBS14710
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10147-CHRBS14710
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10147-CMRBS14710
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10147-CYRBS14710
Человек RSK4 Джин клон кДНК в вектор клонированияHG10147-MRBS5130
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10147-NFRBS14710
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10147-NHRBS14710
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10147-NMRBS14710
Человек RSK4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10147-NYRBS14710
Человек RSK4 Джин ORF экспрессии кДНК клона плазмидыHG10147-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Ribosomal protein S6 kinase alpha-6, also known as Ribosomal S6 kinase 4, 90 kDa ribosomal protein S6 kinase 6,RSK-4, RSK4 and RPS6KA6, is a protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA6 contains one AGC-kinase C-terminal domain and two protein kinase domains. RPS6KA6 forms a complex with either ERK1 or ERK2 in quiescent cells. RPS6KA6 shows a high level of homology to three isolated members of the human RSK family. RSK2 is involved in Coffin-Lowry syndrome and nonspecific MRX. The localization of RPS6KA6 in the interval that is commonly deleted in mentally retarded males together with the high degree of amino acid identity with RSK2 suggests that RPS6KA6 plays a role in normal neuronal development. Further mutation analyses in males with X-linked mental retardation must prove that the gene of RPS6KA6 is indeed a novel MRX gene. RPS6KA6 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA6 is activated by multiple phosphorylations on threonine and serine residues.

Size / Price
Каталог: HG10147-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.