After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human RPS2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_002952.3
Размер кДНК:882bp
Описание кДНК:Full length Clone DNA of Homo sapiens ribosomal protein S2.
Синоним гена:S2, LLREP3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16154-ACGRBS15400
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16154-ACRRBS15400
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG16154-ANGRBS15400
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG16154-ANRRBS15400
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16154-CFRBS13340
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16154-CHRBS13340
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16154-CMRBS13340
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16154-CYRBS13340
Человек RPS2 Джин клон кДНК в вектор клонированияHG16154-GRBS5130
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16154-NFRBS13340
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16154-NHRBS13340
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16154-NMRBS13340
Человек RPS2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16154-NYRBS13340
Человек RPS2 Джин ORF экспрессии кДНК клона плазмидыHG16154-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16154-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».